Phylogenetic analysis of halophyte-associated rhizobacteria and effect of halotolerant and halophilic phosphate-solubilizing biofertilizers on maize growth under salinity stress conditions.

AIMS: The main objective of the present work was to evaluate plant growth-promoting abilities of bacterial strains from the rhizosphere of halophytes and their effect on maize growth under salinity stress. METHODS AND RESULTS: Halophilic bacteria were identified using 16S rRNA sequence analysis and their plant growth-promoting abilities were characterized. Phylogenetic analysis showed that bacterial strains belonging to Bacillus, Halobacillus and Pseudomonas were dominant in the rhizosphere of halophytes. More than 93% strains showed P-solubilization activity and IAA production. About 54% strains were able to produce ACC deaminase, 29% strains showed positive results for nitrogen fixation, 41 and 21% strains showed siderophores and HCN production ability respectively. More than 90% strains showed antifungal activity against more than two fungal pathogens and production of different hydrolytic enzymes. To study the plant growth-promoting effect on maize, five bacterial strains Bacillus safensis HL1HP11 and Bacillus pumilus HL3RS14, Kocuria rosea HL1RP8, Enterobacter aerogenes AT1HP4 and Aeromonas veronii AT1RP10 were used as inoculants; in the form of seed coat and enriched soil-based phosphate biofertilizers. All bacterial strains positively affected the maize growth as compared to non-inoculated control + NaCl plants. Plants inoculated with Bacillus HL3RS14-based soil biofertilizers showed maximum increase in dry weights of root (48-124%) and shoot (52-131%) as compared to control + NaCl (soil + rock phosphate, no inoculum). PGPR inoculations under salinity stress conditions showed high concentrations of proline, glycine betaine and malondialdehyde. CONCLUSION: These results indicated that under saline soil conditions, halophilic PGPR strains combined with carrier materials are promising candidates as biofertilizers.

Ochrobactrum ciceri sp. nov., isolated from nodules of Cicer arietinum.

A Gram-staining-negative, aerobic, rod-shaped, non-spore-forming bacterial strain, Ca-34(T), was isolated from nodules of chickpea (Cicer arietinum) in Pakistan and studied for its taxonomic affiliation. The almost full-length 16S rRNA gene sequence showed highest similarities to those of strains of the genus Ochrobactrum. Based on results of MALDI-TOF MS and 16S rRNA gene sequence similarity (98.6 %), strain Ca-34(T) and Ochrobactrum intermedium LMG 3301(T) are phylogenetic neighbours; the two strains shared DNA-DNA relatedness of 64 %. The fatty acid profile [predominantly C(18 : 1)omega7c (67.7 %) and C(19 : 0) cyclo omega8c (19.6 %)] also supported the genus affiliation. Metabolically, strain Ca-34(T) differed from other type strains of Ochrobactrum in many reactions and from all type strains in testing positive for gelatin hydrolysis and in testing negative for assimilation of alaninamide and l-threonine. Based on phenotypic and genotypic data, we conclude that strain Ca-34(T) represents a novel species, for which we propose the name Ochrobactrum ciceri sp. nov. (type strain Ca-34(T) =DSM 22292(T) =CCUG 57879(T)).

Probiotics and their fermented food products are beneficial for health.

Probiotics are usually defined as microbial food supplements with beneficial effects on the consumers. Most probiotics fall into the group of organisms' known as lactic acid-producing bacteria and are normally consumed in the form of yogurt, fermented milks or other fermented foods. Some of the beneficial effect of lactic acid bacteria consumption include: (i) improving intestinal tract health; (ii) enhancing the immune system, synthesizing and enhancing the bioavailability of nutrients; (iii) reducing symptoms of lactose intolerance, decreasing the prevalence of allergy in susceptible individuals; and (iv) reducing risk of certain cancers. The mechanisms by which probiotics exert their effects are largely unknown, but may involve modifying gut pH, antagonizing pathogens through production of antimicrobial compounds, competing for pathogen binding and receptor sites as well as for available nutrients and growth factors, stimulating immunomodulatory cells, and producing lactase. Selection criteria, efficacy, food and supplement sources and safety issues around probiotics are reviewed. Recent scientific investigation has supported the important role of probiotics as a part of a healthy diet for human as well as for animals and may be an avenue to provide a safe, cost effective, and 'natural' approach that adds a barrier against microbial infection. This paper presents a review of probiotics in health maintenance and disease prevention.

First Report of Cotton Leaf Curl Disease in Central and Southern Sindh Province in Pakistan.

Cotton leaf curl is a devastating disease of cotton that has resulted in severe losses (estimated at more than US$87 million per annum) in Pakistan. The epidemic is centered in Punjab, the province that contributes approximately 80% of Pakistan's cotton. Previously, the disease had been observed sporadically on single plants in the northern Sindh Province but did not cause economically significant damage. During the years 2004 and 2005, a high incidence (approximately 20%) of the disease was observed in Shahdadpur and parts of District Sanghar, located in central Sindh Province. The disease was also observed at low incidence (<1%) in southern Sindh. To confirm the identity of the causal agent of the disease, 18 samples from three districts in central southern Sindh (Sanghar, Hala, and Hyderabad) were collected, and total DNA was extracted using cetyltrimethylammoniumbromide (2). Universal primers for begomoviruses based on conserved sequences as follows were used in polymerase chain reaction (PCR): BegomoF (5'-CCGTGCTGCTGCCCCCATTGTCCGCGTCAC-3') and BegomoR (5'-CTGCCACAACCATGGATTCACGCACAGGG-3'). Universal primers for amplification of DNA ß with PCR were also used (1). A full-length clone of Cotton leaf curl Multan virus (CLCuMV) was labeled with alpha-32PdCTP by the oligo-labeling method and used as a probe in Southern hybridization for the detection of geminivirus DNA forms (2). Similarly, cotton leaf curl disease associated DNA ß was also labeled and used as a probe in Southern hybridization. The use of universal primers for begomoviruses resulted in amplification of viral DNA of the expected size from all samples while no PCR product was obtained from healthy plants. PCR results confirmed that all plants were infected with begomoviruses. Southern hybridization with CLCuMV and DNA ß probes detected begomovirus DNA forms associated with virus replication when washed at medium stringency, further confirming that the plants were infected with the cotton leaf curl geminivirus complex (2). Our results indicate that cotton leaf curl complex has become established in central and southern districts of Sindh Province and it poses a major threat to cotton grown in the region. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2). S. Mansoor et al. Arch. Virol. 148:1969, 2003.

Characterization and screening of bacteria from rhizosphere of maize grown in Indonesian and Pakistani soils.

Thirty rhizobacteria isolated from maize grown in Pakistani and Indonesian soils were evaluated for their morphological characteristics, nitrogen fixation, P-solubilization, indole acetic acid (IAA) and siderophores production. Nitrogenase activity was detected in nineteen isolates ranging from 21.8-3624 n moles C2H4 produced/h/mg protein. Most of the isolates produced IAA, ten were capable of siderophore production while four were P-solubilizers. Ultrastructural studies of Pseudomonas sp. F14 indicated characteristic rhizospheric colonization within 48 h that was observed to change considerably with the passage of time from few bacteria to micro colonies. Random amplified polymorphic DNA (RAPD) analysis of 30 bacterial strains using 30 oligonucleotide primers resulted in considerable level of genetic diversity, with genetic distance ranging from 2-16%. Indonesian isolates were found to be more diverse as compared to Pakistani isolates. The characterization and screening of rhizobacteria of maize rhizosphere has helped in selection of isolates F7, LS-1, 3.1.1.C, F2, F3 and F13 as superior strains for use as bioinoculant. Moreover isolate F14 identified, as Pseudomonas fulgida by partial 16S rRNA sequence analysis is a novel strain regarding its tremendous potentials for inoculum production to enhance the yield of maize.

Transgenic tobacco expressing geminiviral RNAs are resistant to the serious viral pathogen causing cotton leaf curl disease.

Cotton, the major cash crop in Pakistan, suffers 30% losses to cotton leaf curl disease, caused by the geminivirus, cotton leaf curl virus DNA A, plus a satellite component, DNA beta responsible for symptom development with plants failing to produce cotton bolls. We constructed transgenic tobacco expressing sense and antisense RNAs representing: [i] the 5' half of the viral DNA replication gene, AC1, [ii] the 3' half of AC1, [iii] two overlapping genes, AC2, a transcription activator, and AC3, a replication enhancer. In contrast to controls, 25% of 72 transgenic tobacco lines tested showed heritable resistance [T(1) - T(3) generations]: symptom-free and no replication of DNA A or DNA beta even after 120 days of continuous exposure to viruliferous whiteflies. As geminiviral and transgene RNAs are not detected in resistant lines following infection, and selected uninfected resistant tobacco sense lines reveal double-stranded and small interfering RNAs, the most likely mechanism is via post-transcriptional gene silencing.

Cotton leaf curl disease is associated with multiple monopartite begomoviruses supported by single DNA beta.

For bipartite begomoviruses (family Geminiviridae) trans-replication of the DNA B component by the DNA A-encoded replication-associated protein (Rep) is achieved by virtue of a shared sequence, the "common region", which contains repeated motifs (iterons) which are sequence-specific Rep binding sites and form part of the origin of replication. Recently cotton leaf curl disease (CLCuD), a major constraint to cotton production on the Indian subcontinent, has been shown to be caused by a monopartite begomovirus ( Cotton leaf curl Multan virus [CLCuMV]) and a novel single-stranded DNA satellite molecule termed CLCuD DNA beta. The satellite molecule is trans-replicated by CLCuMV but does not possess the iteron sequences of this virus. We have investigated the ability of CLCuD DNA beta to interact with three further clones of monopartite begomoviruses, isolated from cotton, that have distinct Rep binding specificities. All three cloned viruses were capable of trans-replicating the satellite molecule and inducing CLCuD symptoms in cotton, indicating that the interaction between begomovirus and DNA beta is relaxed in comparison to the interaction between DNA A and DNA B components. Field surveys across all the cotton growing regions of Pakistan indicate that dual and multiple infections are the norm for CLCuD with no evidence of synergism. Despite the diversity of begomoviruses associated with CLCuD, only a single class of DNA beta has been detected, suggesting that this satellite has the capacity to be recruited by unrelated begomoviruses.

Halobacillus karajensis sp. nov., a novel moderate halophile.

A moderately halophilic, gram-positive, spore-forming bacterium was isolated from surface saline soil of the Karaj region, Iran. The strain, designated MA-2T, was strictly aerobic with rod-shaped cells that occurred singly, in pairs or short chains. It contained L-Om-D-Asp-type peptidoglycan and the major respiratory lipoquinone was MK-7. It was non-motile and had an ellipsoidal endospore located centrally or subterminally. Growth occurred at 10-49 degrees C and in the pH range 6.0-9.6. Strain MA-2T grew at salinities of 1-24% (w/v) NaCl, showing optimal growth at 10% (w/v). The DNA G + C content was 41.3 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain MA-2T was associated with Bacillus rRNA group 1. The micro-organisms showing the closest phylogenetic relationship to strain MA-2T were Halobacillus litoralis and Halobacillus trueperi. On the basis of phenotypic and chemotaxonomic characteristics, 16S rRNA gene sequence analysis and DNA-DNA similarity data, it is proposed that strain MA-2T (= DSM 14948T = LMG 21515T) should be placed in the genus Halobacillus as the type strain of a novel species, Halobacillus karajensis sp. nov.

Identification of dna components required for induction of cotton leaf curl disease.

Cotton leaf curl disease (CLCuD) is a major constraint to cotton production in Pakistan. Infectious clones of the monopartite begomovirus cotton leaf curl virus (CLCuV), associated with diseased cotton, are unable to induce typical symptoms in host plants. We have identified and isolated a single-stranded DNA molecule approximately 1350 nucleotides in length which, when coinoculated with the begomovirus to cotton, induces symptoms typical of CLCuD, including vein swelling, vein darkening, leaf curling, and enations. This molecule (termed DNA beta) requires the begomovirus for replication and encapsidation. The CLCuV/DNA 1/DNA beta complex, together with a similar complex previously identified in Ageratum conyzoides, represent members of an entirely new type of infectious, disease-causing agents. The implications of this finding to our understanding of the evolution of new disease-causing agents are discussed.

Identification of Candida tropicalis HSR1, a gene of the heat-shock factor-related family, which confers salt tolerance in Saccharomyces cerevisiae.

A genomic library of Candida tropicalis in a yeast multicopy plasmid has been screened for clones conferring salt tolerance upon transformation into S. cerevisiae. The best halotolerance clone contained an open reading frame encoding a predicted protein of 728 amino acids with homology to transcription factors of the heat-shock family. This novel gene was named HSR1 and is present in single copy in the C. tropicalis genome. Upon transformation into S. cerevisiae it increases the expression of ENA1, a major determinant of salt tolerance encoding a cation-extrusion pump. The sequence of CtHSR1 has been deposited in the EMBL data library under Accession No. AJ296093.

Isolation and 16S rRNA sequence analysis of the beneficial bacteria from the rhizosphere of rice.

The present study deals with the isolation of plant growth promoting rhizobacteria (PGPR) from rice (variety NIAB IRRI-9) and the beneficial effects of these inoculants on two Basmati rice varieties. Nitrogen-fixing activity (acetylene-reduction activity) was detected in the roots and submerged shoots of field-grown rice variety NIAB IRRI-9. Estimation of the population size of diazotrophic bacteria by ARA-based MPN (acetylene reduction assay-based most probable number) in roots and shoots indicated about 10(5)-10(6) counts/g dry weight at panicle initiation and grain filling stages. Four bacterial isolates from rice roots and shoots were obtained in pure culture which produced phytohormone indoleacetic acid (IAA) in the growth medium. Among these, three isolates S1, S4, and R3 reduced acetylene to ethylene in nitrogen-free semi-solid medium. Morphological and physiological characteristics of the isolates indicated that three nitrogen-fixing isolates S1, S4, and R3 belonged to the genus Enterobacter, while the non-fixing isolate R8 belonged to the genus Aeromonas. 16S rRNA sequence of one isolate from root (R8) and one isolate from shoot (S1) was obtained which confirmed identification of the isolates as Aeromonas veronii and Enterobacter cloacae, respectively. The 1517-nucleotide-long sequence of the isolate R8 showed 99% similarity with Aeromonas veronii (accession No. AF099023) while partial 16S rRNA sequence (two stretches of total 1271 nucleotide length) of S1 showed 97% similarity with the sequence of Enterobacter cloacae (accession No. AJ251469). The seedlings of two rice varieties Basmati 385 and Super Basmati were inoculated with the four bacterial isolates from rice and one Azospirillum brasilense strain Wb3, which was isolated from wheat. In the rice variety Basmati 385, maximum increase in root area and plant biomass was obtained in plants inoculated with Enterobacter S1 and Azospirillum Wb3, whereas in the rice variety Super Basmati, inoculation with Enterobacter R3 resulted in maximum increase of root area and plant biomass. Nitrogen fixation was quantified by using 15N isotopic dilution method. Maximum fixation was observed in Basmati 385 with the inoculants Azospirillum Wb3 and Enterobacter S1 where nearly 46% and 41% of the nitrogen was derived from atmosphere (%Ndfa), respectively. In general, higher nitrogen fixation was observed in variety Basmati 385 than in Super Basmati, and different bacterial strains were found more effective as inoculants for the rice varieties Basmati 385 and Super Basmati.

Widespread Occurrence of Cotton leaf curl virus on Radish in Pakistan.

The current epidemic of cotton leaf curl disease (CLCuD) in Pakistan started in 1988 with the natural host range limited to a few plant species in the family Malvaceae. However, we have observed expansion in the host range of the virus, and several non-Malvaceous plants were found to be infected with the virus. Characteristic symptoms of CLCuD such as leaf curl and enations have been observed on radish plants, primarily in kitchen gardens. However, in 1999, levels of infection of 10 to 90% were observed both in commercial fields and kitchen gardens in the Punjab province of Pakistan. Both symptomatic and nonsymptomatic samples were collected from five different locations. Total DNA was isolated, dot-blotted on nylon membrane, and a full-length clone corresponding to DNA A of cotton leaf curl virus was labeled with 32P dCTP and used as a probe for the detection of a begomovirus. Strong signals were observed in symptomatic plants while no signals were observed in nonsymptomatic plants. Infection with a begomovirus was further confirmed by polymerase chain reaction (PCR) using degenerate primers for DNA A (1). Primers specific for the two distinct begomoviruses associated with CLCuD were also used in PCR reactions (2), and products of the expected size were obtained from all symptomatic samples, confirming infection with begomoviruses similar to those associated with CLCuD. A full-length probe of a nanovirus-like molecule associated with cotton leaf disease (3), called DNA 1 was labeled with 32P dCTP and detected the virus only in symptomatic plants. Similarly, primers specific for DNA 1 (3) amplified a product of expected size when used in PCR. On the basis of symptomatology and the detection of specific viral components associated with the disease, we confirmed that radish plants are infected with Cotton leaf curl virus (CLCuV). Since radish is a short duration crop, infection of CLCuV in radish may not serve as a direct source of infection for the next cotton crop. However, it is a potential threat to tomato crops which overlap with radish in the Punjab province. The detection of CLCuD in radish is another example of the mobilization of begomoviruses to previously unknown hosts. References: (1) M. R. Rojas et al. Plant Dis. 77:340, 1993. (2) S. Mansoor et al. Pak. J. Bot. 31:115, 1999. (3) Mansoor et al. Virology 259:190, 1999.

Evidence that Watermelon Leaf Curl Disease in Pakistan Is Associated with Tomato Leaf Curl Virus-India, a Bipartite Begomovirus.

Whitefly-transmitted geminiviruses (begomoviruses) have emerged as major constraints on food and fiber crops worldwide, and there are several examples of begomovirus mobilization in previously unknown host plants. Here we report on evidence that leaf curl disease of watermelon in Pakistan is caused by Tomato leaf curl virus-India (TLCV-India). Leaf curl disease of watermelon, characterized by leaf curling and mottling and stunted plant growth, was observed at several locations in the Punjab Province of Pakistan. Symptomatic and asymptomatic leaf samples were collected from three locations, and total DNA was isolated by the cetyltrimethylammoniumbromide method and resolved in agarose gel. A full-length clone of Cotton leaf curl virus DNA A was labeled with [32P]dCTP and used as a general probe in Southern hybridization. The probe detected characteristic geminivirus DNA forms in infected watermelon plants, whereas no signal was detected in asymptomatic plants. The association of a begomovirus was confirmed further by polymerase chain reaction (PCR) amplification with degenerate primers PAL1V and pAR1c (2). Samples were screened for infection by TLCV-India, because of symptom similarity. A full-length clone of DNA B of TLCV-India (1) was labeled with [32P]dCTP by random priming and was used as a specific probe in Southern hybridization. The probe detected geminivirus DNA forms, showing that the disease is associated with TLCV-India. Primers TLCV1 (GAGGTACCAAAACTTGTCGTTTTGATTCGG), in the virion-sense, and TLCV2 (GCCCATGGTTCTTTGCTCGGAGAACAAGAA), in the complementary-sense, were designed based on the sequence of DNA A of TLCV-India. These primers were used in PCR and amplified a product of the expected size from infected plants. Similarly, primers TLCVBC1 (GCGGATCCTTATTCCGTAATTATATCTGCA), in the virion-sense, and TLCV BC2 (CACCATGGCAATAGGAAATGATGGTATGGG), in the complementary-sense, were designed based on the sequence of DNA B of TLCV-India (1). These primers amplified a product of expected size when used in PCR. The results show that watermelon leaf curl disease in Pakistan is associated with TLCV-India. This the first report of detection of a begomovirus in watermelon in Pakistan and the first report of detection of TLCV-India on a plant other than tomato from Southeast Asia. References: (1) M. Padidam et al. J. Gen. Virol. 76:25, 1995. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Animal cell-death suppressors Bcl-x(L) and Ced-9 inhibit cell death in tobacco plants.

In plants, events similar to programmed cell death have been reported [1] [2], although little is known of their mechanisms at the molecular level. To investigate the mechanism(s) involved, we overexpressed bcl-x(L), which encodes a mammalian suppressor of programmed cell death, in tobacco plants, under the control of a strong promoter [3]. In plants expressing Bcl-x(L), cell death induced by UV-B irradiation, paraquat treatment or the hypersensitive reaction (HR) to tobacco mosaic virus (TMV) infection was suppressed. The extent of suppression of cell death depended on the amount of Bcl-x(L) protein expressed. Similar enhanced resistance to cell death was found in transgenic tobacco plants overexpressing the ced-9 gene, a Caenorhabditis elegans homolog of bcl-x(L) [4], indicating that Bcl-x(L) and Ced-9 can function to inhibit cell death in plants.

Identification of a novel circular single-stranded DNA associated with cotton leaf curl disease in Pakistan.

Recent reports have suggested that cotton leaf curl virus (CLCuV), a geminivirus of the genus Begomovirus, may be responsible for cotton leaf curl disease in Pakistan. However, the causal agent of the disease remains unclear as CLCuV genomic components resembling begomovirus DNA A are unable to induce typical disease symptoms when reintroduced into plants. All attempts to isolate a genomic component equivalent to begomovirus DNA B have been unsuccessful. Here, we describe the isolation and characterisation of a novel circular single-stranded (ss) DNA associated with naturally infected cotton plants. In addition to a component resembling DNA A, purified geminate particles contain a smaller unrelated ssDNA that we refer to as DNA 1. DNA 1 was cloned from double-stranded replicative form of the viral DNA isolated from infected cotton plants. Blot hybridisation using probes specific for either CLCuV DNA or DNA 1 was used to demonstrate that both DNAs co-infect naturally infected cotton plants from different geographical locations. DNA 1 was detected in viruliferous Bemisia tabaci and in tobacco plants infected under laboratory conditions using B. tabaci, indicating that it is transmitted by whiteflies. Sequence analysis showed that DNA 1 is approximately half the size of CLCuV DNA but shares no homology, indicating that it is not a defective geminivirus component. DNA 1 has some homology to a genomic component of members of Nanoviridae, a family of DNA viruses that are normally transmitted by aphids or planthoppers. DNA 1 encodes a homologue of the nanovirus replication-associated protein (Rep) and has the capacity to autonomously replicate in tobacco. The data suggest that a nanovirus-like DNA has become whitefly-transmissible as a result of its association with a geminivirus and that cotton leaf curl disease may result from a mutually dependent relationship that has developed between members of two distinct DNA virus families that share a similar replication strategy.

Preservation of some extremely thermophilic chemolithoautotrophic bacteria by deep-freezing and liquid-drying methods.

Long-term preservation methods for extreme thermophilic chemolithoautotrophic bacteria representing various species are described. The cultures were cryopreserved in liquid nitrogen under anaerobic conditions using 5% dimethylsulfoxide as a cryoprotectant. For easy storage and transport, the cultures were successfully liquid-dried, directly from the liquid phase without involving freezing under semiaerobic conditions using effective protective agents such as ethylenediamine and meso-inositol. The tested cultures showed good stability and survival rates after drying, after cryopreservation and on long-term storage. All tested strains were successfully preserved and reactivated within relatively short time. The viability, stability and ability of chemolithoautotrophic growth was not affected. Cryopreservation, liquid-drying and reactivation under microaerobic conditions proved very effective for these oxygen sensitive cultures.

Cloning and expression of beta-glucosidase genes in Escherichia coli and Saccharomyces cerevisiae using shuttle vector pYES 2.0.

Genes for beta-glucosidase (Bgl) isolated from a genomic library of the cellulolytic bacterium, Cellulomonas biazotea, were cloned in pUC18 in its SacI cloning site and transformed to E. coli. Ten putative recombinants showed blackening zones on esculin plates, yellow zones on pNPG plates, in liquid culture and on native polyacrylamide gel electrophoresis activity gels. They fell into three distinct groups. Three representative E. coli clones carried recombinant plasmids designated pRM54, pRM1 and pRM17. The genes were located on 5.6-, 3.7- and 1.84-kb fragments, respectively. Their location was obtained by deletion analysis which revealed that 5.5, 3.2, and 1.8 kb fragments were essential to code for BglA, BglB, and BglC, respectively, and conferred intracellular production of beta-glucosidase on E. coli. Expression of the bgl genes resulted in overproduction of beta-glucosidase in the three clones. Secretion occurred into the periplasmic fractions. Three inserts carrying bgl genes from the representative recombinant E. coli were isolated with SacI, ligated in the shuttle vector pYES 2.0 in its SacI site and transformed to E. coli and S. cerevisiae. The recombinant plasmids were redesignated pRPG1, pRPG2 and pRPG3 coding for BglA1, BglB1 and BglC1. The cloned genes conferred extracellular production of beta-glucosidase on S. cerevisiae and enabled it to grow on cellobiose and salicin. The gall promoter of shuttle vector pYES 2.0 enabled the organisms to produce twice more beta-glucosidase than that supported by the lacZ-promoter of pUC18 plasmid in E. coli. The cloned gene can be used as a selection marker for introducing recombinant plasmids in wild strains of S. cerevisiae. The enzyme produced by bgl+ yeast and E. coli recombinants resembles that of the donor with respect to temperature and pH requirement for maximum activity. Other enzyme properties of the beta-glucosidases from S. cerevisiae were substantially the same as those from C. biazotea.

Enhanced production of cellulases byCellulomonas strains grown on different cellulosic residues.

Cellulomonas strains consumed commercial cellulose, cellulosic residues, xylan, cellobiose and carboxymethyl cellulose (CMC) as carbon sources in liquid culture, the growth being the most on cellobiose medium. All three components of the cellulase complex ofCellulomonas were produced when the organisms utilized all substrates as sole carbon and energy sources. The filter-paper cellulase (FPase) and endo-glucanase (CMCase) activities were higher in media containing alpha-cellulose and cellulosic residues than in media containing CMC, cellobiose, and xylan. Cell-free supernatants of all organisms exhibited greater CMC hydrolyzing activity than filter paper and beta-glucoside hydrolyzing activities. All strains synthesized beta-glucosidase maximally on cellobiose followed by commercial cellulose and cellulosic residues.C. biazotea produced the highest FPase and CMCase activity during growth on alpha-cellulose. It was followed byC. flavigena, C. cellasea, andC. fimi. Endo-glucanase and FPase from all organisms were secreted into the medium; 10-13 % became adsorbed on the surface of the insoluble substrates and could be successfully eluted using Tween 80. beta-Glucosidase was located in cell extracts from all organisms.C. biazotea produced FPase and beta-glucosidase activities several-fold greater than those produced by many other strains ofCellulomonas and some other cellulolytic bacteria and fungi.

Evidence for the Association of a Bipartite Geminivirus with Tomato Leaf Curl Disease in Pakistan.

Tomato leaf curl disease is the most important constraint on tomato production in Pakistan, where it is found throughout the country. The disease, which occurs in high incidence in Punjab and Sindh provinces, causes 30 to 40% yield losses in the spring crop and uneconomically high losses when grown as an autumn crop. The symptoms of the disease include upward or downward leaf curling, vein thickening, and stunting of the plant. The disease is transmitted by Bemisia tabaci whiteflies (non-B, biotype K) and is suspected to be caused by a geminivirus. For the detection of geminivirus, total DNA was extracted from infected plants, fractionated in an agarose gel, transferred to a nylon membrane, and Southern blotted. A full-length clone of DNA-A of cotton leaf curl virus from Pakistan (S. Mansoor, I. Bedford, M. S. Pinner, A. Bashir, R. Briddon, J. Stanley, Y. Zafar, K. A. Malik, and P. G. Markham, unpublished) was labeled with [32P]dCTP by the oligo-labeling method and hybridized at medium stringency. Geminivirus DNA forms that are normally found in infected plants were detected in plants with tomato leaf curl disease but not in healthy plants. To further confirm the presence of a whiteflytransmitted geminivirus, universal primers for dicot-infecting geminiviruses (1) were used in polymerase chain reaction (PCR) and a product of expected size (approximately 2.7 kb) was detected. The 2.7-kb PCR-amplified DNA from diseased tomato plants was labeled with [32P]dCTP and used as probe in Southern hybridization. This probe also detected geminivirus DNA forms at medium stringency. Both monopartite and bipartite geminiviruses transmitted by whiteflies have been reported to cause leaf curl symptoms on tomato from the Eastern hemisphere. Degenerate primers (PBLv2040 and PCRc1), which amplify B component DNA, were used to determine if tomato leaf curl was monopartite or bipartite (2). A product of expected size (0.65 kb) was amplified, suggesting this virus to be bipartite. DNA-B PCR product obtained from diseased tomato plants was hybridized as described above and detected geminivirus DNA forms at medium stringency. Samples of diseased tomato plants were collected from tomato fields throughout Punjab. DNA-A was detected in all 20 samples whereas DNA B was detected in 17 samples when hybridized by dot blot method at medium stringency. Our data show that tomato leaf curl virus from Pakistan is a bipartite geminivirus. This is the first evidence for a bipartite geminivirus in tomato plants from Pakistan. References: (1) R. W. Briddon and P. G. Markham. Mol. Biotechnol. 1:202, 1993. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Genetic diversity evaluation of some elite cotton varieties by RAPD analysis.

Random amplified polymorphic DNA (RAPD) analysis was used to evaluate the genetic diversity of elite commercial cotton varieties. Twenty two varieties belonging to Gossypium hirsutum L. and one to G. arboreum L. were analyzed with 50 random decamer primers using the polymerase chain reaction (PCR). Forty nine primers detected polymorphism in all 23 cotton varieties, while one produced monomorphic amplification profiles. A total of 349 bands were amplified, 89.1% of which were polymorphic. Cluster analysis by the unweighted pair group method of arithmetic means (UPGMA) showed that 17 varieties can be placed in two groups with a similarity ranging from 81.51% to 93.41%. G. hirsutum L. varieties S-12, V3 and MNH-93 showed a similarity of 78.12, 74.46 and 69.56% respectively with rest of the varieties. One variety, CIM-1100, showed 57.02% similarity and was quite distinct. The diploid cotton G. arboreum L. var. Ravi was also very distinct from rest of its tetraploid counterparts and showed only 55.7% similarity. The analysis revealed that the intervarietal genetic relationships of several varieties is related to their center of origin. As expected, most of the varieties have a narrow genetic base. The results obtained can be used for the selection of possible parents to generate a mapping population. The results also reveal the genetic relationship of elite commercial cotton varieties with some standard "Coker" varieties and the diploid G. arboreum L. var. Ravi (old world cotton).